NAME: 				pENTR -TOPO 
RESISTANT MARKER:		Kanamycin resistant; 25 µg/ml
SOURCE: 				Invitrogen Life Technologies
V_TYPE: 				Gateway entry vector
SEQUENCING PRIMERS: 		M13(-21), M13 reverse, T7


Note the specific antibiotic to be used with this vector.
Confirm sequencing primer sequences match vector before sequencing.
Visit the homepage of Invitrogen for more information on this vector.

Cloning:

RIKEN amplified target cDNAs by PCR using the following primers:

Forward: GAAGGAGCCGCCACCATG<gene specific> 
Reverse: CAATTTCACACAGGAAACTCA<gene specific> 

PCR products of the right size were cloned into pENTR-TOPO vector using the Invitrogen TOPO TA cloning kit 

Flanking cDNA sequences:

Vector: TOPO TA cloning site "T">GAAGGAGCCGCCACCATG[insert: PCR product (CDS region)]TGAGTTTCCTGTGTGAAATTG<"A" Vector: TOPO TA cloning site


All ORF clones are provided in Entry Vectors for the Invitrogen Gateway&reg; 
cloning system. Invitrogen offers a whole range of Destination Vectors for 
a wide range of applications. Refer to the homepage of Invitrogen for further 
information on the GatewayR cloning system and related Invitrogen products at:
<a href="http://www.invitrogen.com/content.cfm?pageid=4072">http://www.invitrogen.com/content.cfm?pageid=4072</a>
For further technical information visit our homepage at: <a href="http://www.dnaform.jp">http://www.dnaform.jp</a> 
or contact us under: <a href="mailto:techinfo@dnaform.jp">techinfo@dnaform.jp</a>.