NAME: pENTR223.1 RESISTANT MARKER: Spectinomycin resistant; 100 ��g/ml SOURCE: Invitrogen Life Technologies V_TYPE: Gateway entry vector SEQUENCING PRIMERS: M13(-21), T7 POLYLINKER SEQUENCE: GCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTC TTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGT TCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTA CAAAAAAGCAGAAG-linker-ORF-linker-GCCCAGCTTTCTTGTAC AAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACA GGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCC CCTATAGTGAGTCGTATTACATGGTCAT Note the specific antibiotic to be used with this vector. Confirm sequencing primer sequences match vector before sequencing. All ORF clones are provided in Entry Vectors for the Invitrogen GatewayR cloning system. Invitrogen offers a whole range of Destination Vectors for a wide range of applications. Refer to the homepage of Invitrogen for further information on the GatewayR cloning system and related Invitrogen products at: http://www.invitrogen.com/content.cfm?pageid=4072 For further information on the ORFeome Collaboration, visit their homepage at http://www.orfeomecollaboration.org/html/index.shtml. For further technical information visit our homepage at: http://www.dnaform.jp or contact us under: techinfo@dnaform.jp.