Help

DNAFORM Search Engine

Vector: pYX-AscSource: MGCCollection: IRAVDownload PDF Document
Name: pYX-Asc
Source: Columbia University/Soares
Vector type: plasmid
Selection marker: Ampicillin resistant; 50-200 µg/ml
Polylinker sequence:
attaattaaccctcactaaagggacctaactataacggtcctaaggtagc
gagcggccgcggccagggaggccgatatcgaattcggcgcgccgtcgact
ttcattacctctttctccgcaccccacataaatctccctatagtgagtcg
tattaacatg

Sequencing primer: t7, t3, custom
1 attaattaac cctcactaaa gggacctaac tataacggtc ctaaggtagc gagcggccgc 60
61 ggccagggag gccgatatcg aattcggcgc gccgtcgact ttcattacct ctttctccgc 120
121 accccacata aatctcccta tagtgagtcg tattaacatg tgagcaaaag gccagcaaaa 180
181 ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga 240
241 cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag 300
301 ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct 360
361 taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg 420
421 ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc 480
481 ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt 540
541 aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta 600
601 tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaagaac 660
661 agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc 720
721 ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat 780
781 tacgcgcaga aaaaaaggat ctcaagaaga tccttaccaa tgcttaatca gtgaggcacc 840
841 tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat 900
901 aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc 960
961 acgctcaccg gctccagatt tatcagcaat aaaccagcca gcggaagggc cgagcgcaga 1020
1021 agtggtcctg caactttatc cgcctccatc cagtctatta attgttgccg ggaagctaga 1080
1081 gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg ccattgctac aggcatcgtg 1140
1141 gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga 1200
1201 gttacatgat cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt 1260
1261 gtcagaagta agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct 1320
1321 cttactgtca tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca 1380
1381 ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat acgggataat 1440
1441 accgcgccac atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga 1500
1501 aaactctcaa ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc 1560
1561 aactgatctt cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg 1620
1621 caaaatgccg caaaaaaggg aataagggcg acacggaaat gttgaatact catactcttc 1680
1681 ctttttcaat 1690


Home cDNA Library DeepCAGE Service Clone Distribution

Powered by Japan Bioinformatics K.K.