Help

DNAFORM Search Engine

Vector: pSPORT1Source: MGCCollection: IRAVDownload PDF Document
Name: pCMV-SPORT
Source: Invitrogen Life Technologies
Vector type: phagemid
Selection marker: Ampicillin resistant; 50-200 µg/ml
Polylinker sequence:
taatacgactcactatagggagagagctatgacgtcgcatgcacgcgtaa
gcttgggcccctcgagggatcctctagagcggccgc{3' - cDNA ins
ert - 5'}cggACGCGTgggtcgacccgggaattccggaccggtacctg
caggcgtaccttctatagtgtcacctaaatagctttttgcaaaagcctag
gctagagtccggagg{CMV Promoter}

Sequencing primers: t7, sp6

1 cattcgccat tcaggctgcg caactgttgg gaagggcgat cggtgcgggc ctcttcgcta 60
61 ttacgccagc tggcgaaagg gggatgtgct gcaaggcgat taagttgggt aacgccaggg 120
121 ttttcccagt cacgacgttg taaaacgacg gccagtgaat tgaatttagg tgacactata 180
181 gaagagctat gacgtcgcat gcacgcgtac gtaagcttgg atcctctaga gcggccgccg 240
241 actagtgagc tcgtcgaccc gggaattccg gaccggtacc tgcaggcgta ccagctttcc 300
301 ctatagtgag tcgtattaga gcttggcgta atcatggtca tagctgtttc ctgtgtgaaa 360
361 ttgttatccg ctcacaattc cacacaacat acgagccgga agcataaagt gtaaagcctg 420
421 gggtgcctaa tgagtgagct aactcacatt aattgcgttg cgctcactgc ccgctttcca 480
481 gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg ggagaggcgg 540
541 tttgcgtatt gggcgccagg gtggtttttc ttttcaccag tgagacgggc aacagctgat 600
601 tgcccttcac cgcctggccc tgagagagtt gcagcaagcg gtccacgctg gtttgcccca 660
661 gcaggcgaaa atcctgtttg atggtggttg acggcgggat ataacatgag ctgtcttcgg 720
721 tatcgtcgta tcccactacc gagatatccg caccaacgcg cagcccggac tcggtaatgg 780
781 cgcgcattgc gcccagcgcc atctgatcgt tggcaaccag catcgcagtg ggaacgatgc 840
841 cctcattcag catttgcatg gtttgttgaa aaccggacat ggcactccag tcgccttccc 900
901 gttccgctat cggctgaatt tgattgcgag tgagatattt atgccagcca gccagacgca 960
961 gacgcgccga gacagaactt aatgggcccg ctaacagcgc gatttgctgg tgacccaatg 1020
1021 cgaccagatg ctccacgccc agtcgcgtac cgtcttcatg ggagaaaata atactgttga 1080
1081 tgggtgtctg gtcagagaca tcaagaaata acgccggaac attagtgcag gcagcttcca 1140
1141 cagcaatggc atcctggtca tccagcggat agttaatgat cagcccactg acccgttgcg 1200
1201 cgagaagatt gtgcaccgcc gctttacagg cttcgacgcc gcttcgttct accatcgaca 1260
1261 ccaccacgct ggcacccagt tgatcggcgc gagatttaat cgccgcgaca atttgcgacg 1320
1321 gcgcgtgcag ggccagactg gaggtggcaa cgccaatcag caacgactgt ttgcccgcca 1380
1381 gttgttgtgc cacgcggttg ggaatgtaat tcagctccgc catcgccgct tccacttttt 1440
1441 cccgcgtttt cgcagaaacg tggctggcct ggttcaccac gcgggaaacg gtctgataag 1500
1501 agacaccggc atactctgcg acatcgtata acgttactgg tttcacattc accaccctga 1560
1561 attgactctc ttccgggcgc tatcatgcca taccgcgaaa ggttttgcgc cattcgatgg 1620
1621 tgtcaacgta aatgccgctt cgccttcgcg cgcgaattgc aagctctgca ttaatgaatc 1680
1681 ggccaacgcg cggggagagg cggtttgcgt attgggcgct cttccgcttc ctcgctcact 1740
1741 gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta 1800
1801 atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag 1860
1861 caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc 1920
1921 cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta 1980
1981 taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg 2040
2041 ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcaatgc 2100
2101 tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac 2160
2161 gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac 2220
2221 ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg 2280
2281 aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga 2340
2341 aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt 2400
2401 agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag 2460
2461 cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct 2520
2521 gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg 2580
2581 atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat 2640
2641 gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc 2700
2701 tgtctatttc gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgg 2760
2761 gagggcttac catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct 2820
2821 ccagatttat cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca 2880
2881 actttatccg cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg 2940
2941 ccagttaata gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt gtcacgctcg 3000
3001 tcgtttggta tggcttcatt cagctccggt tcccaacgat caaggcgagt tacatgatcc 3060
3061 cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag 3120
3121 ttggccgcag tgttatcact catggttatg gcagcactgc ataattctct tactgtcatg 3180
3181 ccatccgtaa gatgcttttc tgtgactggt gagtactcaa ccaagtcatt ctgagaatag 3240
3241 tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac gggataatac cgcgccacat 3300
3301 agcagaactt taaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaagg 3360
3361 atcttaccgc tgttgagatc cagttcgatg taacccactc gtgcacccaa ctgatcttca 3420
3421 gcatctttta ctttcaccag cgtttctggg tgagcaaaaa caggaaggca aaatgccgca 3480
3481 aaaaagggaa taagggcgac acggaaatgt tgaatactca tactcttcct ttttcaatat 3540
3541 tattgaagca tttatcaggg ttattgtctc atgagcggat acatatttga atgtatttag 3600
3601 aaaaataaac aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgaaattgta 3660
3661 aacgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc attttttaac 3720
3721 caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga gatagggttg 3780
3781 agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc caacgtcaaa 3840
3841 gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg aaccatcacc ctaatcaagt 3900
3901 tttttggggt cgaggtgccg taaagcacta aatcggaacc ctaaagggag cccccgattt 3960
3961 agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa agcgaaagga 4020
4021 gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcc 4080
4081 gcgcttaatg cgccgctaca gggcgcgtc 4109


Home cDNA Library DeepCAGE Service Clone Distribution

Powered by Japan Bioinformatics K.K.