Help

DNAFORM Search Engine

Vector: pOTB7Source: MGCCollection: IRAUDownload PDF Document
Name: pOTB7
Source: UCBerkeley/Rubin
Vector type: plasmid
Selection marker: Chloramphenicol resistant; 25 µg/ml
Polylinker sequence:
cgttagaacgcggctacaattaatacataaccttatgtatcatacacata
cgatttaggtgacactatagaactcgaaggatccacaagtttgtacaaaa
aagcaggcttgtaaaacgacggccagtaactataacggtcctaaggtagc
gaggcctgggtggcgaattcccttactagtttccctcgaggcatctatgt
cgggtgcggagaaagaggtaatgaaatggcacatggtcatagctgtttcc
tgacccagctttcttgtacaaagtggtagatctgccggtctccctatagt
gagtcgtattaatttcgataagccaggttaacctgcattaatgaatcggc
tgcagtacccgggaatttaacccgcctaatgagcgggctttt

Sequencing primers: M13(-21), M13 reverse, t7, sp6
1 cgttagaacg cggctacaat taatacataa ccttatgtat catacacata cgatttaggt 60
61 gacactatag aactcgaagg atccacaagt ttgtacaaaa aagcaggctt gtaaaacgac 120
121 ggccagtaac tataacggtc ctaaggtagc gaggcctggg tggcgaattc ccttactagt 180
181 ttccctcgag gcatctatgt cgggtgcgga gaaagaggta atgaaatggc acatggtcat 240
241 agctgtttcc tgacccagct ttcttgtaca aagtggtaga tctgccggtc tccctatagt 300
301 gagtcgtatt aatttcgata agccaggtta acctgcatta atgaatcggc tgcagtaccc 360
361 gggaatttaa cccgcctaat gagcgggctt ttttttgtga tccaaaggat cttcttgaga 420
421 tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt 480
481 ggtttgtttg ccggatcaag agctaccaac tctttttccg aaggtaactg gcttcagcag 540
541 agcgcagata ccaaatactg ttcttctagt gtagccgtag ttaggccacc acttcaagaa 600
601 ctctgtagca ccgcctacat acctcgctct gctaatcctg ttaccagtgg ctgctgccag 660
661 tggcgataag tcgtgtctta ccgggttgga ctcaagacga tagttaccgg ataaggcgca 720
721 gcggtcgggc tgaacggggg gttcgtgcac acagcccagc ttggagcgaa cgacctacac 780
781 cgaactgaga tacctacagc gtgagctatg agaaagcgcc acgcttcccg aagggagaaa 840
841 ggcggacagg tatccggtaa gcggcagggt cggaacagga gagcgcacga gggagcttcc 900
901 agggggaaac gcctggtatc tttatagtcc tgtcgggttt cgccacctct gacttgagcg 960
961 tcgatttttg tgatgctcgt caggggggcg gagcctatgg aaaaacgcca gcaacgcgga 1020
1021 tcacaacaaa aagcccgctc attaggcggg ctaaattctc atgtttgaca gcttatcatc 1080
1081 gataagctag cggccgctag ctttaatgag ttatcgagat tttcaggagc taaggaagct 1140
1141 aaaatggaga aaaaaatcac tggatatacc accgttgata tatcccaatg gcatcgtaaa 1200
1201 gaacattttg aggcatttca gtcagttgct caatgtacct ataaccagac cgttcagctg 1260
1261 gatattacgg cctttttaaa gaccgtaaag aaaaataagc acaagtttta tccggccttt 1320
1321 attcacattc ttgcccgcct gatgaatgct catccggagt tccgtatggc aatgaaagac 1380
1381 ggtgagctgg tgatatggga tagtgttcac ccttgttaca ccgttttcca tgagcaaact 1440
1441 gaaacgtttt catcgctctg gagtgaatac cacgacgatt tccggcagtt tctacacata 1500
1501 tattcgcaag atgtggcgtg ttacggtgaa aacctggcct atttccctaa agggtttatt 1560
1561 gagaatatgt ttttcgtctc agccaatccc tgggtgagtt tcaccagttt tgatttaaac 1620
1621 gtggccaata tggacaactt cttcgccccc gttttcacca tgggcaaata ttatacgcaa 1680
1681 ggcgacaagg tgctgatgcc gctggcgatt caggttcatc atgccgtttg tgatggcttc 1740
1741 catgtcggca gaatgcttaa tgaattacaa cagtactgcg atgagtggca gggcggggcg 1800
1801 taattggtac gtcga 1815


Home cDNA Library DeepCAGE Service Clone Distribution

Powered by Japan Bioinformatics K.K.