Help

DNAFORM Search Engine

Vector: pDNR-LIBSource: MGCCollection: IRAUDownload PDF Document
Name: pDNR-LIB
Sourse: Clontech
Vector type: plasmid
Selection marker: Chloramphenicol resistant; 25 µg/ml
Polylinker sequence:
gcggccgcataacttcgtatagcatacattatacgaagttatcagtcgac
ggtaccggacatatgcccgggaattcggccattacggcctgcaggatccg
aaaaaacctcccacacctccccctgaacctgaaacataaaatgaatgcaa
ttgttgttgttaacttgtttattgcagcttataatggttacaaataaagc
aatagcatcacaaatttcacaaataaagcatttttttcactgcattctag
ttgtggtttgtccaaactcatcaatgtatcttatcatgtctggatccggc
cgcctcggccctcgagaagctttctagaccattcgtttggcgcgcgggcc
cagtaggtaagtgaacatggtcatagctgtttccctaggagatcctggta
tgactagtgcttggattctcaccaataaaaaacgcccggcggcaaccgag
cgttctgaacaaatccagatggagttctgaggtcattactggatctatca

Sequencing primers: M13(-21)
1 gcggccgcat aacttcgtat agcatacatt atacgaagtt atcagtcgac ggtaccggac 60
61 atatgcccgg gaattcggcc attacggcct gcaggatccg aaaaaacctc ccacacctcc 120
121 ccctgaacct gaaacataaa atgaatgcaa ttgttgttgt taacttgttt attgcagctt 180
181 ataatggtta caaataaagc aatagcatca caaatttcac aaataaagca tttttttcac 240
241 tgcattctag ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc tggatccggc 300
301 cgcctcggcc ctcgagaagc tttctagacc attcgtttgg cgcgcgggcc cagtaggtaa 360
361 gtgaacatgg tcatagctgt ttccctagga gatcctggta tgactagtgc ttggattctc 420
421 accaataaaa aacgcccggc ggcaaccgag cgttctgaac aaatccagat ggagttctga 480
481 ggtcattact ggatctatca acaggagtcc aagcgagctc gatatcaaat tacgccccgc 540
541 cctgccactc atcgcagtac tgttgtaatt cattaagcat tctgccgaca tggaagccat 600
601 cacaaacggc atgatgaacc tgaatcgcca gcggcatcag caccttgtcg ccttgcgtat 660
661 aatatttgcc catggtgaaa acgggggcga agaagttgtc catattggcc acgtttaaat 720
721 caaaactggt gaaactcacc cagggattgg ctgagacgaa aaacatattc tcaataaacc 780
781 ctttagggaa ataggccagg ttttcaccgt aacacgccac atcttgcgaa tatatgtgta 840
841 gaaactgccg gaaatcgtcg tggtattcac tccagagcga tgaaaacgtt tcagtttgct 900
901 catggaaaac ggtgtaacaa gggtgaacac tatcccatat caccagctca ccgtctttca 960
961 ttgccatacg aaattccgga tgagcattca tcaggcgggc aagaatgtga ataaaggccg 1020
1021 gataaaactt gtgcttattt ttctttacgg tctttaaaaa ggccgtaata tccagctgaa 1080
1081 cggtctggtt ataggtacat tgagcaactg actgaaatgc ctcaaaatgt tctttacgat 1140
1141 gccattggga tatatcaacg gtggtatatc cagtgatttt tttctccatt ttagcttcct 1200
1201 tagctcctga aagatccata acttcgtata gcatacatta tacgaagtta tgcggccgcg 1260
1261 acgtcaatgc caataggata tcggcatttt cttttgcgtt tttatttgtt aactgttaat 1320
1321 tgtccttgtt caaggatgct gtctttgaca acagatgttt tcttgccttt gatgttcagc 1380
1381 aggaagctag gcgcaaacgt tgattgtttg tctgcgtaga atcctctgtt tgtcatatag 1440
1441 cttgtaatca cgacattgtt tcctttcgct tgaggtacag cgaagtgtga gtaagtaaag 1500
1501 gttacatcgt taggatcaag atccattttt aacacaaggc cagttttgtt cagcggcttg 1560
1561 tatgggccag ttaaagaatt agaaacataa ccaagcatgt aaatatcgtt agacgtaatg 1620
1621 ccgtcaatcg tcatttttga tccgcgggag tcagtgaaca ggtaccattt gccgttcatt 1680
1681 ttaaagacgt tcgcgcgttc aatttcatct gttactgtgt tagatgcaat cagcggtttc 1740
1741 atcacttttt tcagtgtgta atcatcgttt agctcaatca taccgagagc gccgtttgct 1800
1801 aactcagccg tgcgtttttt atcgctttgc agaagttttt gactttcttg acggaagaat 1860
1861 gatgtgcttt tgccatagta tgctttgtta aataaagatt cttcgccttg gtagccatct 1920
1921 tcagttccag tgtttgcttc aaatactaag tatttgtggc ctttatcttc tacgtagtga 1980
1981 ggatctctca gcgtatggtt gtcgcctgag ctgtagttgc cttcatcgat gaactgctgt 2040
2041 acattttgat acgtttttcc gtcaccgtca aagattgatt tataatcctc tacaccgttg 2100
2101 atgttcaaag agctgtctga tgctgatacg ttaacttgtg cagttgtcag tgtttgtttg 2160
2161 ccgtaatgtt taccggagaa atcagtgtag aataaacgga tttttccgtc agatgtaaat 2220
2221 gtggctgaac ctgaccattc ttgtgtttgg tcttttagga tagaatcatt tgcatcgaat 2280
2281 ttgtcgctgt ctttaaagac gcggccagcg tttttccagc tgtcaataga agtttcgccg 2340
2341 actttttgat agaacatgta aatcgatgtg tcatccgcat ttttaggatc tccggctaat 2400
2401 gcaaagacga tgtggtagcc gtgatagttt gcgacagtgc cgtcagcgtt ttgtaatggc 2460
2461 cagctgtccc aaacgtccag gccttttgca gaagagatat ttttaattgt ggacgaatcg 2520
2521 aactcaggaa cttgattttt tcattttttt gctgttcagg gatttgcagc atatcatggc 2580
2581 gtgtaatatg ggaaatgccg tatgtttcct tatatggctt ttggttcgtt tctttcgcaa 2640
2641 acgcttgagt tgcgcctcct gccagcagtg cggtagtaaa ggttaatact gttgcttgtt 2700
2701 ttgcaaactt tttgatgttc atcgttcatg tctccttttt tatgtactgt gttagcggtc 2760
2761 tgcttcttcc agccctcctg tttgaagatg gcaagttagt tacgcacaat aaaaaaagac 2820
2821 ctaaaatatg taaggggtga cgccaaagta tacactttgc cctttacaca ttttaggtct 2880
2881 tgcctgcttt atcagtaaca aacccgcgcg atttactttt cgacctcatt ctattagact 2940
2941 ctcgtttgga ttgcaactgg tctattttcc tcttttgttt gatagaaaat cataaaagga 3000
3001 tttgcagact acgggcctaa agaactaaaa aatctatctg tttcttttca ttctctgtat 3060
3061 tttttatagt ttctgttgca tgggcataaa gttgcctttt taatcacaat tcagaaaata 3120
3121 tcataatatc tcatttcact aaataatagt gaacggcagg tatatgtggc gcgcctaagc 3180
3181 attggtaact gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt 3240
3241 tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt 3300
3301 aacgtgagtt ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt 3360
3361 gagatccttt ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag 3420
3421 cggtggtttg tttgccggat caagagctac caactctttt tccgaaggta actggcttca 3480
3481 gcagagcgca gataccaaat actgttcttc tagtgtagcc gtagttaggc caccacttca 3540
3541 agaactctgt agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg 3600
3601 ccagtggcga taagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg 3660
3661 cgcagcggtc gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct 3720
3721 acaccgaact gagataccta cagcgtgagc tatgagaaag cgccacgctt cccgaaggga 3780
3781 gaaaggcgga caggtatccg gtaagcggca gggtcggaac aggagagcgc acgagggagc 3840
3841 ttccaggggg aaacgcctgg tatctttata gtcctgtcgg gtttcgccac ctctgacttg 3900
3901 agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac gccagcaacg 3960
3961 cggccttttt acggttcctg gccttttgct ggccttttgc tcacatgttc tttcctgcgt 4020
4021 tatcccctga ttctgtggat aaccgtatta ccgccttacg cgtgtaaaac gacggccagt 4080
4081 agatctgtaa tacgactcac tatagggcgc tagctcgccg cagccgaacg accgagcgca 4140
4141 gcgagtcagt gagcgaggaa 4160


Home cDNA Library DeepCAGE Service Clone Distribution

Powered by Japan Bioinformatics K.K.