Help

DNAFORM Search Engine

Vector: pCR4-TOPOSource: MGCCollection: IRCLDownload PDF Document
Name: pCR4-TOPO
Source: Invitrogen Life Technologies
Vector type: plasmid
Selection marker: Kanamycin resistant; 25 µg/ml
Polylinker sequence:
gcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcac
gacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgt
gagttagctcactcattaggcaccccaggctttacactttatgcttccgg
ctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaac
agctatgaccatgattacgccaagctcagaattaaccctcactaaaggga
ctagtcctgcaggtttaaacgaattcgcccttaagggcgaattcgcggcc
gctaaattcaattcgccctatagtgagtcgtattacaattcactggccgt
cgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatc
gccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcc
cgcaccgatcgcccttcccaacagttgcgcagcctatacgtacggcagtt
taaggtttacacctataaaagagagagccgttatcgtctgtttgtggatg
tacagagtgatattattgacacgccggggcgacggatggtgatccccctg
gccagtgcacgtctgctg

Sequencing primers: M13(-21), M13 reverse, t7, t3
1 AGCGCCCAAT ACGCAAACCG CCTCTCCCCG CGCGTTGGCC GATTCATTAA TGCAGCTGGC 60
61 ACGACAGGTT TCCCGACTGG AAAGCGGGCA GTGAGCGCAA CGCAATTAAT GTGAGTTAGC 120
121 TCACTCATTA GGCACCCCAG GCTTTACACT TTATGCTTCC GGCTCGTATG TTGTGTGGAA 180
181 TTGTGAGCGG ATAACAATTT CACACAGGAA ACAGCTATGA CCATGATTAC GCCAAGCTCA 240
241 GAATTAACCC TCACTAAAGG GACTAGTCCT GCAGGTTTAA ACGAATTCGC CCTTAAGGGC 300
301 GAATTCGCGG CCGCTAAATT CAATTCGCCC TATAGTGAGT CGTATTACAA TTCACTGGCC 360
361 GTCGTTTTAC AACGTCGTGA CTGGGAAAAC CCTGGCGTTA CCCAACTTAA TCGCCTTGCA 420
421 GCACATCCCC CTTTCGCCAG CTGGCGTAAT AGCGAAGAGG CCCGCACCGA TCGCCCTTCC 480
481 CAACAGTTGC GCAGCCTATA CGTACGGCAG TTTAAGGTTT ACACCTATAA AAGAGAGAGC 540
541 CGTTATCGTC TGTTTGTGGA TGTACAGAGT GATATTATTG ACACGCCGGG GCGACGGATG 600
601 GTGATCCCCC TGGCCAGTGC ACGTCTGCTG TCAGATAAAG TCTCCCGTGA ACTTTACCCG 660
661 GTGGTGCATA TCGGGGATGA AAGCTGGCGC ATGATGACCA CCGATATGGC CAGTGTGCCG 720
721 GTCTCCGTTA TCGGGGAAGA AGTGGCTGAT CTCAGCCACC GCGAAAATGA CATCAAAAAC 780
781 GCCATTAACC TGATGTTCTG GGGAATATAA ATGTCAGGCA TGAGATTATC AAAAAGGATC 840
841 TTCACCTAGA TCCTTTTCAC GTAGAAAGCC AGTCCGCAGA AACGGTGCTG ACCCCGGATG 900
901 AATGTCAGCT ACTGGGCTAT CTGGACAAGG GAAAACGCAA GCGCAAAGAG AAAGCAGGTA 960
961 GCTTGCAGTG GGCTTACATG GCGATAGCTA GACTGGGCGG TTTTATGGAC AGCAAGCGAA 1020
1021 CCGGAATTGC CAGCTGGGGC GCCCTCTGGT AAGGTTGGGA AGCCCTGCAA AGTAAACTGG 1080
1081 ATGGCTTTCT TGCCGCCAAG GATCTGATGG CGCAGGGGAT CAAGCTCTGA TCAAGAGACA 1140
1141 GGATGAGGAT CGTTTCGCAT GATTGAACAA GATGGATTGC ACGCAGGTTC TCCGGCCGCT 1200
1201 TGGGTGGAGA GGCTATTCGG CTATGACTGG GCACAACAGA CAATCGGCTG CTCTGATGCC 1260
1261 GCCGTGTTCC GGCTGTCAGC GCAGGGGCGC CCGGTTCTTT TTGTCAAGAC CGACCTGTCC 1320
1321 GGTGCCCTGA ATGAACTGCA AGACGAGGCA GCGCGGCTAT CGTGGCTGGC CACGACGGGC 1380
1381 GTTCCTTGCG CAGCTGTGCT CGACGTTGTC ACTGAAGCGG GAAGGGACTG GCTGCTATTG 1440
1441 GGCGAAGTGC CGGGGCAGGA TCTCCTGTCA TCTCACCTTG CTCCTGCCGA GAAAGTATCC 1500
1501 ATCATGGCTG ATGCAATGCG GCGGCTGCAT ACGCTTGATC CGGCTACCTG CCCATTCGAC 1560
1561 CACCAAGCGA AACATCGCAT CGAGCGAGCA CGTACTCGGA TGGAAGCCGG TCTTGTCGAT 1620
1621 CAGGATGATC TGGACGAAGA GCATCAGGGG CTCGCGCCAG CCGAACTGTT CGCCAGGCTC 1680
1681 AAGGCGAGCA TGCCCGACGG CGAGGATCTC GTCGTGACCC ATGGCGATGC CTGCTTGCCG 1740
1741 AATATCATGG TGGAAAATGG CCGCTTTTCT GGATTCATCG ACTGTGGCCG GCTGGGTGTG 1800
1801 GCGGACCGCT ATCAGGACAT AGCGTTGGCT ACCCGTGATA TTGCTGAAGA GCTTGGCGGC 1860
1861 GAATGGGCTG ACCGCTTCCT CGTGCTTTAC GGTATCGCCG CTCCCGATTC GCAGCGCATC 1920
1921 GCCTTCTATC GCCTTCTTGA CGAGTTCTTC TGAATTATTA ACGCTTACAA TTTCCTGATG 1980
1981 CGGTATTTTC TCCTTACGCA TCTGTGCGGT ATTTCACACC GCATCAGGTG GCACTTTTCG 2040
2041 GGGAAATGTG CGCGGAACCC CTATTTGTTT ATTTTTCTAA ATACATTCAA ATATGTATCC 2100
2101 GCTCATGAGA TTATCAAAAA GGATCTTCAC CTAGATCCTT TTAAATTAAA AATGAAGTTT 2160
2161 TAAATCAATC TAAAGTATAT ATGAGTAAAC TTGGTCTGAC AGTTACCAAT GCTTAATCAG 2220
2221 TGAGGCACCT ATCTCAGCGA TCTGTCTATT TCGTTCATCC ATAGTTGCCT GACTCCCCGT 2280
2281 CGTGTAGATA ACTACGATAC GGGAGGGCTT ACCATCTGGC CCCAGTGCTG CAATGATACC 2340
2341 GCGAGACCCA CGCTCACCGG CTCCAGATTT ATCAGCAATA AACCAGCCAG CCGGAAGGGC 2400
2401 CGAGCGCAGA AGTGGTCCTG CAACTTTATC CGCCTCCATC CAGTCTATTA ATTGTTGCCG 2460
2461 GGAAGCTAGA GTAAGTAGTT CGCCAGTTAA TAGTTTGCGC AACGTTGTTG CCATTGCTAC 2520
2521 AGGCATCGTG GTGTCACGCT CGTCGTTTGG TATGGCTTCA TTCAGCTCCG GTTCCCAACG 2580
2581 ATCAAGGCGA GTTACATGAT CCCCCATGTT GTGCAAAAAA GCGGTTAGCT CCTTCGGTCC 2640
2641 TCCGATCGTT GTCAGAAGTA AGTTGGCCGC AGTGTTATCA CTCATGGTTA TGGCAGCACT 2700
2701 GCATAATTCT CTTACTGTCA TGCCATCCGT AAGATGCTTT TCTGTGACTG GTGAGTACTC 2760
2761 AACCAAGTCA TTCTGAGAAT AGTGTATGCG GCGACCGAGT TGCTCTTGCC CGGCGTCAAT 2820
2821 ACGGGATAAT ACCGCGCCAC ATAGCAGAAC TTTAAAAGTG CTCATCATTG GAAAACGTTC 2880
2881 TTCGGGGCGA AAACTCTCAA GGATCTTACC GCTGTTGAGA TCCAGTTCGA TGTAACCCAC 2940
2941 TCGTGCACCC AACTGATCTT CAGCATCTTT TACTTTCACC AGCGTTTCTG GGTGAGCAAA 3000
3001 AACAGGAAGG CAAAATGCCG CAAAAAAGGG AATAAGGGCG ACACGGAAAT GTTGAATACT 3060
3061 CATACTCTTC CTTTTTCAAT ATTATTGAAG CATTTATCAG GGTTATTGTC TCATGACCAA 3120
3121 AATCCCTTAA CGTGAGTTTT CGTTCCACTG AGCGTCAGAC CCCGTAGAAA AGATCAAAGG 3180
3181 ATCTTCTTGA GATCCTTTTT TTCTGCGCGT AATCTGCTGC TTGCAAACAA AAAAACCACC 3240
3241 GCTACCAGCG GTGGTTTGTT TGCCGGATCA AGAGCTACCA ACTCTTTTTC CGAAGGTAAC 3300
3301 TGGCTTCAGC AGAGCGCAGA TACCAAATAC TGTTCTTCTA GTGTAGCCGT AGTTAGGCCA 3360
3361 CCACTTCAAG AACTCTGTAG CACCGCCTAC ATACCTCGCT CTGCTAATCC TGTTACCAGT 3420
3421 GGCTGCTGCC AGTGGCGATA AGTCGTGTCT TACCGGGTTG GACTCAAGAC GATAGTTACC 3480
3481 GGATAAGGCG CAGCGGTCGG GCTGAACGGG GGGTTCGTGC ACACAGCCCA GCTTGGAGCG 3540
3541 AACGACCTAC ACCGAACTGA GATACCTACA GCGTGAGCTA TGAGAAAGCG CCACGCTTCC 3600
3601 CGAAGGGAGA AAGGCGGACA GGTATCCGGT AAGCGGCAGG GTCGGAACAG GAGAGCGCAC 3660
3661 GAGGGAGCTT CCAGGGGGAA ACGCCTGGTA TCTTTATAGT CCTGTCGGGT TTCGCCACCT 3720
3721 CTGACTTGAG CGTCGATTTT TGTGATGCTC GTCAGGGGGG CGGAGCCTAT GGAAAAACGC 3780
3781 CAGCAACGCG GCCTTTTTAC GGTTCCTGGC CTTTTGCTGG CCTTTTGCTC ACATGTTCTT 3840
3841 TCCTGCGTTA TCCCCTGATT CTGTGGATAA CCGTATTACC GCCTTTGAGT GAGCTGATAC 3900
3901 CGCTCGCCGC AGCCGAACGA CCGAGCGCAG CGAGTCAGTG AGCGAGGAAG CGGAAG 3956


Home cDNA Library DeepCAGE Service Clone Distribution

Powered by Japan Bioinformatics K.K.