Help

DNAFORM Search Engine

Vector: pCR-BluntII-TOPOSource: MGCCollection: IRCMDownload PDF Document
Name: pCR-BluntII-TOPO
Source: Invitrogen Life Technologies
Vector Type: plasmid
Selection marker: kanamycin resistant; 10µg/ml
Polylinker sequence:
acagctatgaccatgattacgccaagctatttaggtgacactatagaata
ctcaagctatgcatcaagcttggtaccgagctcggatccactagtaacgg
ccgccagtgtgctggaattcgcccttaagggcgaattctgcagatatcca
tcacactggcggccgctcgagcatgcatctagagggcccaattcgcccta
tagtgagtcgtattacaattcactggccgtcgttttacaacgtcgtgact
gggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccct
ttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttccca
acagttgcgcagcctatacgtacggcagtttaaggtttacacctataaaa
gagagagccgttatcgtctgtttgtggatgtacagagtgatattattgac
acgccggggcgacggatggtgatccccctggccagtgcacgtctgctgtc
agataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaa
gctggcgcat

Sequencing primers: M13(-21), M13 reverse, t7, sp6
1 AGCGCCCAAT ACGCAAACCG CCTCTCCCCG CGCGTTGGCC GATTCATTAA TGCAGCTGGC 60
61 ACGACAGGTT TCCCGACTGG AAAGCGGGCA GTGAGCGCAA CGCAATTAAT GTGAGTTAGC 120
121 TCACTCATTA GGCACCCCAG GCTTTACACT TTATGCTTCC GGCTCGTATG TTGTGTGGAA 180
181 TTGTGAGCGG ATAACAATTT CACACAGGAA ACAGCTATGA CCATGATTAC GCCAAGCTAT 240
241 TTAGGTGACA CTATAGAATA CTCAAGCTAT GCATCAAGCT TGGTACCGAG CTCGGATCCA 300
301 CTAGTAACGG CCGCCAGTGT GCTGGAATTC GCCCTTAAGG GCGAATTCTG CAGATATCCA 360
361 TCACACTGGC GGCCGCTCGA GCATGCATCT AGAGGGCCCA ATTCGCCCTA TAGTGAGTCG 420
421 TATTACAATT CACTGGCCGT CGTTTTACAA CGTCGTGACT GGGAAAACCC TGGCGTTACC 480
481 CAACTTAATC GCCTTGCAGC ACATCCCCCT TTCGCCAGCT GGCGTAATAG CGAAGAGGCC 540
541 CGCACCGATC GCCCTTCCCA ACAGTTGCGC AGCCTATACG TACGGCAGTT TAAGGTTTAC 600
601 ACCTATAAAA GAGAGAGCCG TTATCGTCTG TTTGTGGATG TACAGAGTGA TATTATTGAC 660
661 ACGCCGGGGC GACGGATGGT GATCCCCCTG GCCAGTGCAC GTCTGCTGTC AGATAAAGTC 720
721 TCCCGTGAAC TTTACCCGGT GGTGCATATC GGGGATGAAA GCTGGCGCAT GATGACCACC 780
781 GATATGGCCA GTGTGCCGGT CTCCGTTATC GGGGAAGAAG TGGCTGATCT CAGCCACCGC 840
841 GAAAATGACA TCAAAAACGC CATTAACCTG ATGTTCTGGG GAATATAAAT GTCAGGCATG 900
901 AGATTATCAA AAAGGATCTT CACCTAGATC CTTTTCACGT AGAAAGCCAG TCCGCAGAAA 960
961 CGGTGCTGAC CCCGGATGAA TGTCAGCTAC TGGGCTATCT GGACAAGGGA AAACGCAAGC 1020
1021 GCAAAGAGAA AGCAGGTAGC TTGCAGTGGG CTTACATGGC GATAGCTAGA CTGGGCGGTT 1080
1081 TTATGGACAG CAAGCGAACC GGAATTGCCA GCTGGGGCGC CCTCTGGTAA GGTTGGGAAG 1140
1141 CCCTGCAAAG TAAACTGGAT GGCTTTCTCG CCGCCAAGGA TCTGATGGCG CAGGGGATCA 1200
1201 AGCTCTGATC AAGAGACAGG ATGAGGATCG TTTCGCATGA TTGAACAAGA TGGATTGCAC 1260
1261 GCAGGTTCTC CGGCCGCTTG GGTGGAGAGG CTATTCGGCT ATGACTGGGC ACAACAGACA 1320
1321 ATCGGCTGCT CTGATGCCGC CGTGTTCCGG CTGTCAGCGC AGGGGCGCCC GGTTCTTTTT 1380
1381 GTCAAGACCG ACCTGTCCGG TGCCCTGAAT GAACTGCAAG ACGAGGCAGC GCGGCTATCG 1440
1441 TGGCTGGCCA CGACGGGCGT TCCTTGCGCA GCTGTGCTCG ACGTTGTCAC TGAAGCGGGA 1500
1501 AGGGACTGGC TGCTATTGGG CGAAGTGCCG GGGCAGGATC TCCTGTCATC TCACCTTGCT 1560
1561 CCTGCCGAGA AAGTATCCAT CATGGCTGAT GCAATGCGGC GGCTGCATAC GCTTGATCCG 1620
1621 GCTACCTGCC CATTCGACCA CCAAGCGAAA CATCGCATCG AGCGAGCACG TACTCGGATG 1680
1681 GAAGCCGGTC TTGTCGATCA GGATGATCTG GACGAAGAGC ATCAGGGGCT CGCGCCAGCC 1740
1741 GAACTGTTCG CCAGGCTCAA GGCGAGCATG CCCGACGGCG AGGATCTCGT CGTGACCCAT 1800
1801 GGCGATGCCT GCTTGCCGAA TATCATGGTG GAAAATGGCC GCTTTTCTGG ATTCATCGAC 1860
1861 TGTGGCCGGC TGGGTGTGGC GGACCGCTAT CAGGACATAG CGTTGGCTAC CCGTGATATT 1920
1921 GCTGAAGAGC TTGGCGGCGA ATGGGCTGAC CGCTTCCTCG TGCTTTACGG TATCGCCGCT 1980
1981 CCCGATTCGC AGCGCATCGC CTTCTATCGC CTTCTTGACG AGTTCTTCTG AATTATTAAC 2040
2041 GCTTACAATT TCCTGATGCG GTATTTTCTC CTTACGCATC TGTGCGGTAT TTCACACCGC 2100
2101 ATACAGGTGG CACTTTTCGG GGAAATGTGC GCGGAACCCC TATTTGTTTA TTTTTCTAAA 2160
2161 TACATTCAAA TATGTATCCG CTCATGAGAC AATAACCCTG ATAAATGCTT CAATAATAGC 2220
2221 ACGTGAGGAG GGCCACCATG GCCAAGTTGA CCAGTGCCGT TCCGGTGCTC ACCGCGCGCG 2280
2281 ACGTCGCCGG AGCGGTCGAG TTCTGGACCG ACCGGCTCGG GTTCTCCCGG GACTTCGTGG 2340
2341 AGGACGACTT CGCCGGTGTG GTCCGGGACG ACGTGACCCT GTTCATCAGC GCGGTCCAGG 2400
2401 ACCAGGTGGT GCCGGACAAC ACCCTGGCCT GGGTGTGGGT GCGCGGCCTG GACGAGCTGT 2460
2461 ACGCCGAGTG GTCGGAGGTC GTGTCCACGA ACTTCCGGGA CGCCTCCGGG CCGGCCATGA 2520
2521 CCGAGATCGG CGAGCAGCCG TGGGGGCGGG AGTTCGCCCT GCGCGACCCG GCCGGCAACT 2580
2581 GCGTGCACTT CGTGGCCGAG GAGCAGGACT GACACGTGCT AAAACTTCAT TTTTAATTTA 2640
2641 AAAGGATCTA GGTGAAGATC CTTTTTGATA ATCTCATGAC CAAAATCCCT TAACGTGAGT 2700
2701 TTTCGTTCCA CTGAGCGTCA GACCCCGTAG AAAAGATCAA AGGATCTTCT TGAGATCCTT 2760
2761 TTTTTCTGCG CGTAATCTGC TGCTTGCAAA CAAAAAAACC ACCGCTACCA GCGGTGGTTT 2820
2821 GTTTGCCGGA TCAAGAGCTA CCAACTCTTT TTCCGAAGGT AACTGGCTTC AGCAGAGCGC 2880
2881 AGATACCAAA TACTGTCCTT CTAGTGTAGC CGTAGTTAGG CCACCACTTC AAGAACTCTG 2940
2941 TAGCACCGCC TACATACCTC GCTCTGCTAA TCCTGTTACC AGTGGCTGCT GCCAGTGGCG 3000
3001 ATAAGTCGTG TCTTACCGGG TTGGACTCAA GACGATAGTT ACCGGATAAG GCGCAGCGGT 3060
3061 CGGGCTGAAC GGGGGGTTCG TGCACACAGC CCAGCTTGGA GCGAACGACC TACACCGAAC 3120
3121 TGAGATACCT ACAGCGTGAG CTATGAGAAA GCGCCACGCT TCCCGAAGGG AGAAAGGCGG 3180
3181 ACAGGTATCC GGTAAGCGGC AGGGTCGGAA CAGGAGAGCG CACGAGGGAG CTTCCAGGGG 3240
3241 GAAACGCCTG GTATCTTTAT AGTCCTGTCG GGTTTCGCCA CCTCTGACTT GAGCGTCGAT 3300
3301 TTTTGTGATG CTCGTCAGGG GGGCGGAGCC TATGGAAAAA CGCCAGCAAC GCGGCCTTTT 3360
3361 TACGGTTCCT GGGCTTTTGC TGGCCTTTTG CTCACATGTT CTTTCCTGCG TTATCCCCTG 3420
3421 ATTCTGTGGA TAACCGTATT ACCGCCTTTG AGTGAGCTGA TACCGCTCGC CGCAGCCGAA 3480
3481 CGACCGAGCG CAGCGAGTCA GTGAGCGAGG AAGCGGAAG 3519


Home cDNA Library DeepCAGE Service Clone Distribution

Powered by Japan Bioinformatics K.K.