Help

DNAFORM Search Engine

Vector: pCMV-SPORT6Source: MGCCollection: IRAVDownload PDF Document
Name: pCMV-SPORT6
Source: Invitrogen Life Technologies
Vector type: phagemid
Selection marker: Ampicillin resistant; 50-200 µg/ml
Polylinker sequence:
gatcccaagctagcagttttcccagtcacgacgttgtaaaacgacggcca
gtgcctagcttataatacgactcactatagggaccactttgtacaagaaa
gctgggtacgcgtaagcttgggcccctcgagggatactctagagcggccg
ccgactagtgagctcgtcgacgatatcccgggaattccggaccggtacca
gcctgcttttttgtacaaacttgttctatagtgtcacctaaataggccta
atggtcatagctgtttcctgtgtgaaatt

Sequencing primers: M13(-21), M13 reverse, t7, sp6
1 ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg cctcttcgct 60
61 attacgccag ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag 120
121 gatcgatcca gacatgataa gatacattga tgagtttgga caaaccacaa ctagaatgca 180
181 gtgaaaaaaa tgctttattt gtgaaatttg tgatgctatt gctttatttg taaccattat 240
241 aagctgcaat aaacaagtta acaacaacaa ttgcattcat tttatgtttc aggttcaggg 300
301 ggaggtgtgg gaggtttttt aaagcaagta aaacctctac aaatgtggta tggctgatta 360
361 tgatcatgaa cagactgtga ggactgaggg gcctgaaatg agccttggga ctgtgaatct 420
421 aaaatacaca aacaattaga atcactagct cctgtgtata atattttcat aaatcatact 480
481 cagtaagcaa aactctcaag cagcaagcat atgcagctag tttaacacat tatacactta 540
541 aaaattttat atttacctta gagctttaaa tctctgtagg tagtttgtcc aattatgtca 600
601 caccacagaa gtaaggttcc ttcacaaaga tcccaagcta gcagttttcc cagtcacgac 660
661 gttgtaaaac gacggccagt gcctagctta taatacgact cactataggg accactttgt 720
721 acaagaaagc tgggtacgcg taagcttggg cccctcgagg gatcctctag agcggccgcc 780
781 gatccggctt actaaaagcc agataacagt atgcgtattt gcgcgctgat ttttgcggta 840
841 taagaatata tactgatatg tatacccgaa gtatgtcaaa aagaggtgtg cttctagaat 900
901 gcagtttaag gtttacacct ataaaagaga gagccgttat cgtctgtttg tggatgtaca 960
961 gagtgatatt attgacacgc ccgggcgacg gatggtgatc cccctggcca gtgcacgtct 1020
1021 gctgtcagat aaagtctccc gtgaacttta cccggtggtg catatcgggg atgaaagctg 1080
1081 gcgcatgatg accaccgata tggccagtgt gccggtctcc gttatcgggg aagaagtggc 1140
1141 tgatctcagc caccgcgaaa atgacatcaa aaacgccatt aacctgatgt tctggggaat 1200
1201 ataagtcgac gatatcccgg gaattccgga ccggtaccag cctgcttttt tgtacaaact 1260
1261 tgttctatag tgtcacctaa ataggcctaa tggtcatagc tgtttcctgt gtgaaattgt 1320
1321 tatccgctcc gcggcctagg ctagagtccg gaggctggat cggtcccggt gtcttctatg 1380
1381 gaggtcaaaa cagcgtggat ggcgtctcca ggcgatctga cggttcacta aacgagctct 1440
1441 gcttatatag acctcccacc gtacacgcct accgcccatt tgcgtcaatg gggcggagtt 1500
1501 gttacgacat tttggaaagt cccgttgatt ttggtgccaa aacaaactcc cattgacgtc 1560
1561 aatggggtgg agacttggaa atccccgtga gtcaaaccgc tatccacgcc cattgatgta 1620
1621 ctgccaaaac cgcatcacca tggtaatagc gatgactaat acgtagatgt actgccaagt 1680
1681 aggaaagtcc cataaggtca tgtactgggc ataatgccag gcgggccatt taccgtcatt 1740
1741 gacgtcaata gggggcgtac ttggcatatg atacacttga tgtactgcca agtgggcagt 1800
1801 ttaccgtaaa tactccaccc attgacgtca atggaaagtc cctattggcg ttactatggg 1860
1861 aacatacgtc attattgacg tcaatgggcg ggggtcgttg ggcggtcagc caggcgggcc 1920
1921 atttaccgta agttatgtaa cgacatgcat ctaatgagtg aaagggcctc gtactacgcc 1980
1981 tatttttata ggttaatgtc atgataataa tggtttctta gacgtcaggt ggcacttttc 2040
2041 ggggaaatgt gcgcggaacc cctatttgtt tatttttcta aatacattca aatatgtatc 2100
2101 cgctcatgag acaataaccc tgataaatgc ttcaataata ttgaaaaacg cgcgaattgc 2160
2161 aagctctgca ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt attgggcgct 2220
2221 cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat 2280
2281 cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga 2340
2341 acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt 2400
2401 ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt 2460
2461 ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc 2520
2521 gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa 2580
2581 gcgtggcgct ttctcaatgc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct 2640
2641 ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta 2700
2701 actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg 2760
2761 gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc 2820
2821 ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta 2880
2881 ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg 2940
2941 gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt 3000
3001 tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg 3060
3061 tcatgccata acttcgtata gcatacatta tacgaagtta tggcatgaga ttatcaaaaa 3120
3121 ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat 3180
3181 atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga 3240
3241 tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata actacgatac 3300
3301 gggagggctt accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg 3360
3361 ctccagattt atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg 3420
3421 caactttatc cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt 3480
3481 cgccagttaa tagtttgcgc aacgttgttg ccattgctac aggcatcgtg gtgtcacgct 3540
3541 cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat 3600
3601 cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta 3660
3661 agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca 3720
3721 tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat 3780
3781 agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat acgggataat accgcgccac 3840
3841 atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa 3900
3901 ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt 3960
3961 cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg 4020
4021 caaaaaaggg aataagggcg acacggaaat gttgaatact catactcttc ctttttcaat 4080
4081 attattgaag catttatcag ggttattgtc tcatgccagg ggtgggcaca catatttgat 4140
4141 accagcgatc cctacacagc acataattca atgcgacttc cctctatcgc acatcttaga 4200
4201 cctttattct ccctccagca cacatcgaag ctgccgagca agccgttctc accagtccaa 4260
4261 gacctggcat gagcggatac atatttgaat gtatttagaa aaataaacaa ataggggttc 4320
4321 cgcgcacatt tccccgaaaa gtgccacctg aaattgtaaa cgttaatatt ttgttaaaat 4380
4381 tcgcgttaaa tttttgttaa atcagctcat tttttaacca ataggccgaa atcggcaaaa 4440
4441 tcccttataa atcaaaagaa tagaccgaga tagggttgag tgttgttcca gtttggaaca 4500
4501 agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg 4560
4561 gcgatggccc actacgtgaa ccatcaccct aatcaagttt tttggggtcg aggtgccgta 4620
4621 aagcactaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg ggaaagccgg 4680
4681 cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa 4740
4741 gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg ccgctacagg 4800
4801 gcgcgtc 4807


Home cDNA Library DeepCAGE Service Clone Distribution

Powered by Japan Bioinformatics K.K.